human osteosarcoma hos (ATCC)
ATCC is a verified supplier 
ATCC manufactures this product 
96
Structured Review
ATCC
human osteosarcoma hos
Human Osteosarcoma Hos, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 927 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+osteosarcoma+hos/HOS%3B+Osteosarcoma%3B+Human/pm41686638-284-16-31
Average 96 stars, based on 927 article reviews
Human Osteosarcoma Hos, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 927 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+osteosarcoma+hos/HOS%3B+Osteosarcoma%3B+Human/pm41686638-284-16-31
Average 96 stars, based on 927 article reviews
human osteosarcoma hos - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Multiple Displacement Amplification:Article Title: Hypoxia restores the acidosis-induced inhibition of cancer cell dissemination Article Snippet: .. Human MDA-MB-231 breast cancer, human HT1080 fibrosarcoma, human HCT116 colon carcinoma, Article Title: Hypoxia restores the acidosis-induced inhibition of cancer cell dissemination. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER latrunculin A Millipore Sigma 2-Deoxy-D-Glucose Cayman Chemical Cat # 14325 n-acetyl cysteine Cayman Chemical Cat # 20261 etomoxir Cayman Chemical Cat # 11969 oligomycin Cayman Chemical Cat # 11342 rotenone Cayman Chemical Cat # 13995 antimycin A Cayman Chemical Cat # 34799 NaHCO3 Gibco Cat # 12800-058 LIVE/DEADTM Viability/Cytotoxicity Kit Invitrogen Cat #L3224 BCECF-AM Thermo Fisher Cat #B1170 pHrodoTM Red-AM Molecular Probes Cat #P35372 Tetramethylrhodamine methyl ester perchlorate Thermo Fisher Cat #T668 Glucose Agilent Cat # 103577-100 Pyruvate Agilent Cat # 103578-100 Glutamine Agilent Cat # 103579-100 Seahorse XF DMEM Medium Agilent Cat # 103575-100 BODIPY Thermo Fisher Cat #D3922 CellROXTM Deep Red Reagent Thermo Fisher Cat #C10422 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid Gibco Cat # 15630080 PIPES Millipore Sigma Cat #P1851 Critical commercial assays Duolink In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich Cat # DUO92101 Cell Counting Kit-8 Dojindo Cat # CK04-11 Deposited data RNA-seq analysis This paper https://github.com/bajpai-lab/Acidosis-Cancer- RNAseq RNA-seq raw data This paper GSE315655 (see https://www.ncbi.nlm.nih.gov/ geo/query/acc.cgi?acc=GSE315655) Experimental models: Cell lines MDA-MB-231 wild-type ATCC Cat # HTB-26 MDA-MB-231 expressing Lifeact-GFP (Bera et al.)20 N/A MDA-MB-231 expressing pHred (Bera et al.)20 N/A HT1080 wild-type ATCC Cat # CCL-121 HCT116 ATCC Cat # CCL-247 A375 ATCC Cat # CRL-1619 HOS ATCC Cat # CRL-1543 Experimental models: Organisms/strains NOD-SCID Gamma (NSG) mice Jackson Laboratory strain #005557 Chick embryo University of Alberta poultry research facility Gallus gallus Oligonucleotides shRNA targeting human EZRIN CCGTGGGATGCTCAAAGATAA This paper N/A ShRNA targeting human NHE1 (1) GACAAGCTCAACCGGTTTAAT ShRNA targeting human NHE1 (2) CCAATCTTAGTTTCTAACCAA This paper N/A non-targeting scramble control GCACTACCAGAGCTAACTCAGATAGTACT This paper N/A (Continued on next page) 18 Cell Reports 45, 116970, February 24, 2026 .. Cell lines and cell culture Human MDA-MB-231 breast cancer, human HT1080 fibrosarcoma, human HCT116 colon carcinoma, Cell Culture:Article Title: Acoustofluidic patterning for improved microtissue histology Article Snippet: .. Article Title: Hypoxia restores the acidosis-induced inhibition of cancer cell dissemination. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER latrunculin A Millipore Sigma 2-Deoxy-D-Glucose Cayman Chemical Cat # 14325 n-acetyl cysteine Cayman Chemical Cat # 20261 etomoxir Cayman Chemical Cat # 11969 oligomycin Cayman Chemical Cat # 11342 rotenone Cayman Chemical Cat # 13995 antimycin A Cayman Chemical Cat # 34799 NaHCO3 Gibco Cat # 12800-058 LIVE/DEADTM Viability/Cytotoxicity Kit Invitrogen Cat #L3224 BCECF-AM Thermo Fisher Cat #B1170 pHrodoTM Red-AM Molecular Probes Cat #P35372 Tetramethylrhodamine methyl ester perchlorate Thermo Fisher Cat #T668 Glucose Agilent Cat # 103577-100 Pyruvate Agilent Cat # 103578-100 Glutamine Agilent Cat # 103579-100 Seahorse XF DMEM Medium Agilent Cat # 103575-100 BODIPY Thermo Fisher Cat #D3922 CellROXTM Deep Red Reagent Thermo Fisher Cat #C10422 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid Gibco Cat # 15630080 PIPES Millipore Sigma Cat #P1851 Critical commercial assays Duolink In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich Cat # DUO92101 Cell Counting Kit-8 Dojindo Cat # CK04-11 Deposited data RNA-seq analysis This paper https://github.com/bajpai-lab/Acidosis-Cancer- RNAseq RNA-seq raw data This paper GSE315655 (see https://www.ncbi.nlm.nih.gov/ geo/query/acc.cgi?acc=GSE315655) Experimental models: Cell lines MDA-MB-231 wild-type ATCC Cat # HTB-26 MDA-MB-231 expressing Lifeact-GFP (Bera et al.)20 N/A MDA-MB-231 expressing pHred (Bera et al.)20 N/A HT1080 wild-type ATCC Cat # CCL-121 HCT116 ATCC Cat # CCL-247 A375 ATCC Cat # CRL-1619 HOS ATCC Cat # CRL-1543 Experimental models: Organisms/strains NOD-SCID Gamma (NSG) mice Jackson Laboratory strain #005557 Chick embryo University of Alberta poultry research facility Gallus gallus Oligonucleotides shRNA targeting human EZRIN CCGTGGGATGCTCAAAGATAA This paper N/A ShRNA targeting human NHE1 (1) GACAAGCTCAACCGGTTTAAT ShRNA targeting human NHE1 (2) CCAATCTTAGTTTCTAACCAA This paper N/A non-targeting scramble control GCACTACCAGAGCTAACTCAGATAGTACT This paper N/A (Continued on next page) 18 Cell Reports 45, 116970, February 24, 2026 .. Cell lines and cell culture Human MDA-MB-231 breast cancer, human HT1080 fibrosarcoma, human HCT116 colon carcinoma, Food & Beverages:Article Title: Lipocalin-2 Inhibits Osteosarcoma Cell Metastasis by Suppressing MET Expression via the MEK–ERK Pathway Article Snippet: .. The |